Вопросы и ответы категории

Mathematics, 27.07.2020 05:01, rhineharttori

Multiply and simplify
(x +1)3 x (x+1)4...

Mathematics, 27.07.2020 05:01, haimar8710

Please Explain:

Why is 1 the maximum possible value of a sine ratio?...

Computers and Technology, 27.07.2020 05:01, nyasiasaunders1234

Hi peeps I feel so sad my frnd is never gon come or maybe she will someday.....

English, 27.07.2020 05:01, shanua

Unscramble the words and phrases to write a sentence. Use correct capitalization and punctuation. frigid / this winter / unlike / last winter / has b...

Mathematics, 27.07.2020 05:01, ravenmcfarlandp07okx

The quadrilateral whose diagonals bisect at right angles is a (A) rhombus
(B) rectangle
(C) trapezium
(D) parallelogram
...

Mathematics, 27.07.2020 05:01, ryantrajean7

Heeeeeeeeeeeeeeeeelp

...

Mathematics, 27.07.2020 05:01, ueuwuwj

Please answer this now in two minutes

...

Mathematics, 27.07.2020 05:01, stump76

What is the product of the polynomials below

...

Social Studies, 27.07.2020 05:01, lilinicholeb

What is the importance of pearl trading in UAE economic growth?...

English, 27.07.2020 05:01, spetgrave069

HELP!!
English class
HELP!!
English class

...

Biology, 27.07.2020 05:01, k3rbycalilung

Cual es el habitat y nicho ecologico del mosquito Aedes Aegypti?...

Mathematics, 27.07.2020 05:01, ghernadez

Rewrite2(4)(6) in a different way, using the Commutative Law of Multiplication....

Biology, 27.07.2020 05:01, yayalovebree

Mapa conceptual de las celulas...

Mathematics, 27.07.2020 05:01, niicoleassssssf

One polygon has a side of length 3 feet. A similar polygon has a corresponding side of length 9 feet. The ratio of the perimeter of the smaller polygo...

Mathematics, 27.07.2020 05:01, MoparorNocar061401

Can someone help me broo!!

...

Mathematics, 27.07.2020 05:01, gabrielolivas59

The graph of the function f(x) = log5 (x) is stretched vertically by a factor of 2, shifted to the left by 8 units, and shifted up by 3 units.
...

Geography, 27.07.2020 05:01, thezbell

Which of the following are reasons that Globalization has occurred? O A
Improvements in shipping and air cargo have driven down transportation...

Mathematics, 27.07.2020 05:01, heggestade

PLEASE HELP BRAINLY INSTANTLY Kira solved the equation in the following way.
7/2 − 2x = 11/2

7/2 − 7/2 − 2x = 11/2 − 7/2

Mathematics, 27.07.2020 05:01, cjrogers4401

(-y^5)(8y^2) and (-7^5)(9y) and (-7^5)(-5)...

Mathematics, 27.07.2020 05:01, losstdr3ams

QUESTION 10
What is the slope of a line that is parallel to the line
2y = 3x - 5...

Mathematics, 27.07.2020 05:01, andybiersack154

Which of the following proves ABC DEF? A.
SAS

B.
SSS

C.
SSA

D.
ASA

Mathematics, 27.07.2020 05:01, felipeee4609

The Marriott family bought a new apartment three years ago for $65,000. The apartment is now worth $86,515. Assuming a steady rate of growth, what was...

Mathematics, 27.07.2020 05:01, nbnb8831

Two forces with magnitudes of 100 and 50 pounds act on an object at angles of 50° and 160°, respectively. Find the direction and magnitude of the resu...

Business, 27.07.2020 05:01, lanaiheart7

Exercise 8-07 At December 31, 2019, Pharoah Company Company had a credit balance of $18,100 in Allowance for Doubtful Accounts. During 2020, Pharoah C...

Mathematics, 27.07.2020 05:01, schwann

Mai invests $20,000 at age 20. She hopes the investment will be worth $500,000 when she turns 40. If the interest compounds continuously, approximatel...

Chemistry, 27.07.2020 05:01, angelashaw449

Given the equation: N2 +202->2NO2, what mass of oxygen is required to react completely with 48.400 g of nitrogen?
Select one:
O a. 110...

Mathematics, 27.07.2020 05:01, benji23

Please help me. Need answer asap.

...

Mathematics, 27.07.2020 05:01, serg42

A parabola has an x-intercept at 2, its axis of symmetry is the line x=4, and the y-coordinate of its vertex is 6. Determine the equation of the parab...

Mathematics, 27.07.2020 05:01, mutoni55

Want to donate to a better cause? Consider micro-lending. Micro-lending is a process where you lend directly to entrepreneurs in developing countries....

Mathematics, 27.07.2020 05:01, wrivera32802

Multiply and simplify (x2)(x4)(x-5)...

Mathematics, 27.07.2020 05:01, namekianball4

QUESTION 8
Simplify the expression
(5-4 (25)*)?
expressing the answer as a power of 5....

Mathematics, 27.07.2020 05:01, GaudySky

A 440 kg roller coaster car is going 26 m/s when it reaches the lowest point on the track. If the car started from rest at the top of a hill, how much...

History, 27.07.2020 05:01, jfernald5658

What did monopolies do that many Americans considered unfair? A) A monopoly allowed a company to pay low wages and charge high prices. B) A monopoly a...

Mathematics, 27.07.2020 05:01, talia43

Se tiene una pirámide regular cuadrangular cuyas caras laterales forman con la base un angulo que mide 53º y el area de la superficie lateral es 60 ¿c...

Mathematics, 27.07.2020 05:01, kelseyxxswd2932

Match each statement with its contrapositive

...

Business, 27.07.2020 05:01, toniawu18

Clarington Company makes three models of phasers. Information on the three products is given below: Stunner Double-Set Mega-Power Sales $301,000 $451,...

Law, 27.07.2020 05:01, Kianaxo

Enunca las razones que hay para superar el egoismo y actuar con justicia. porfavor me ayudan gracias...

Mathematics, 27.07.2020 05:01, lizzyyyvv

Please solve this using quadratic formula :")

...

Mathematics, 27.07.2020 05:01, lilkari5

Which of the following shows the polynomial below written in descending order ?
Which of the fol...</a></div><div class=

Mathematics, 27.07.2020 05:01, roxanneee2145

John needs to produce a scale diagram of a bedroom using a scale of 1:40. The length of the room is 3.4 metres. What is the length on the diagram? ___...

English, 27.07.2020 05:01, lilzaya510

The teacher Reviewing the sentence would point out that says this is a...

History, 27.07.2020 05:01, alivas6618

Save O EXIL Submit For
Score
Now, rank each of the five influential people you selected based on who you think had the greatest impact

Mathematics, 27.07.2020 05:01, Dweath50

Which of the following is not a solution to the inequality graphed below?
Which of the following...</a></div><div class=

Mathematics, 27.07.2020 05:01, bkabyma91

Which equation shows a=bc^2+d solved for c...

Business, 27.07.2020 05:01, mooredollie

Hey everyone! hope you have had/are having a great day...follow me on you tube if you want...

Mathematics, 27.07.2020 05:01, monet83

Need help refer to picture

...

Chemistry, 27.07.2020 05:01, dcarranza626

For the reaction 2HNO3 + Mg(OH)2 + Mg(NO3)2 + 2H20, how many grams of magnesium nitrate are produced from 17.37 mol of nitric acid, HNO3?
Selec...

Mathematics, 27.07.2020 05:01, FailingstudentXD

Which of the following proves ABC DEF? A.
SAS

B.
SSS

C.
SSA

D.
ASA

Mathematics, 27.07.2020 05:01, JC16

What is the range of possible sizes for side xxx? 2.8 and 2.8 are the sides...

Mathematics, 27.07.2020 05:01, originalbeast6p2799m

What is the equation of the graph below?

...

Advanced Placement (AP), 27.07.2020 05:01, nubsies31

TE 28 True
False
The components of a split system are purchased separately and assembled at the job site,...

Law, 27.07.2020 05:01, jeremiahhart13

Which of the following individual freedoms is protected under the bill of rights...

Mathematics, 27.07.2020 05:01, mecennabosaaen

Use the equation of the curve of best fit you found in part A to predict what the daily rental price for a two-bedroom condo will be in June. What wil...

Mathematics, 27.07.2020 05:01, michaellagann2020

Mai invests $20,000 at age 20. She hopes the investment will be worth $500,000 when she turns 40. If the interest compounds continuously, approximatel...

Health, 27.07.2020 05:01, robert7248

Choose the best word/s to match the following statement: The numerous ways in which individuals and groups differ in their beliefs, behaviors, values,...

Business, 27.07.2020 05:01, owenr4758

Clarington Company makes three models of phasers. Information on the three products is given below: Stunner Double-Set Mega-Power Sales $301,000 $451,...

Mathematics, 27.07.2020 05:01, jones03riley

Find the inverse of function f f(x)=1/3-1/21x...

Mathematics, 27.07.2020 05:01, victory08

IM BEING TIMED, WILL GIVE 25 POINTS (NEEDED WITHIN THE NEXT 20 MINUTES The graph g(x)=x^3-x is shown. (idk how to screenshot, so please pull it up on...

English, 27.07.2020 05:01, jennyferalbarracin64

Select the correct answer from the drop-down menu. A unique characteristic of a written text is that it A. Requires readers to use their imagination B...

Social Studies, 27.07.2020 05:01, kmc3490

Until recently, CEOs and management teams at large in U.S. companies have focused solely on __________....

Mathematics, 27.07.2020 05:01, twirlergirl406

The manager of a used car lot took inventory of the automobiles on his lot and constructed the following table based on the age of his car and its ma...

History, 27.07.2020 05:01, maya9681

"Three Sisters" farming was an agricultural system of companion planting innovated by the Iroquois- speaking peoples of the Northeast; farmers plante...

Biology, 27.07.2020 05:01, xochitlbmartine

when does mutation have the greatest effect; translation, RNA synthesis, DNA Replication or somatic cell formation?...

History, 27.07.2020 05:01, blue5488

Naval units of the Communist regime in Vietnam . . . have deliberately and repeatedly attacked United States naval vessels lawfully present in interna...

Business, 27.07.2020 05:01, xojade

Which negotiation approaches rainbow paints and xingpe are using?

....

Biology, 27.07.2020 05:01, hannahkharel2

Determine whether the following species are extinct, endangered, or threatened. The Tasmanian tiger, the largest known carnivorous marsupial, was wip...

Biology, 27.07.2020 05:01, bladencharles8845

Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC
How many bases are in the second fragment?...

History, 27.07.2020 05:01, anyaivy44

Make a list of arguments that support the US annexation of Hawaii. Select one argument and write a brief justification of 50 to 60 words....

Mathematics, 27.07.2020 05:01, sierrawalk2283

Jacob spends 60 minutes in the gym every day doing freehand exercises and running on the treadmill. He runs on the treadmill 30 minutes more than he d...

Mathematics, 27.07.2020 05:01, lyly214

-2log(1-4x)+7 find the inverse...

Mathematics, 27.07.2020 05:01, jeanieb

Did this several times but still didn't get the answer .pls do try this :)
Did this several tim...</a></div><div class=

History, 27.07.2020 05:01, tarabrett8863

Which of the following MOST influenced the progressive education movement started by John Dewey? (A)
William James
(B)
Robert La Fo...

History, 27.07.2020 05:01, shouyuanroh3685

What special factors allowed maya/Mayans to rise and be successful?...

English, 27.07.2020 05:01, maderaada

The dog curled up in bed. What is the predicate of the sentence?...

Biology, 27.07.2020 05:01, rachelkorkees

What are the strengths and weakness of the cell
model...

Medicine, 27.07.2020 05:01, emmaishere69

1. Discuss the roots of psychology, especially connections and the emergence of psychology as a science. In your response, consider psychology from a...

Mathematics, 27.07.2020 05:01, robclark128

The volume of a rectangular prism is given by the formula V = lwh, where l is the length of the prism, w is the width, and h is the height. Suppose a...

Mathematics, 27.07.2020 05:01, niescarlosj

A collection of 108 coins containing only quarters and nickels is worth $21. A table titled Coin Collection showing Number of Coins, Value, and Total....

Mathematics, 27.07.2020 05:01, sheccidmariscal9428

In a recent election, there were six candidates and 4300 total votes. The circle graph below summarizes the votes by candidate. The central angle for...

Chemistry, 27.07.2020 05:01, cody1097

If you recorded the final volume of NaOH as 39.88 ml instead of 38.88 ml?...

Physics, 27.07.2020 05:01, priscillaoliver4487

Una persona lanza una pelota hacia arriba con una velocidad de 15 metros por segundo. - Calcule: o Altura máxima que alcanza la pelota o Tiempo en el...

Chemistry, 27.07.2020 05:01, alexismoran1495

URGENT PLS HELP A solution contains the following ions, each in 0.1 M concentration: Ag+ (aq), Ba2+(aq), Al3+ (aq). Refer to the solubility table and...

Mathematics, 27.07.2020 05:01, PONBallfordM89

How much would Stephanie have in her account after 6 months if interest was not compounded, and the bank only used a simple interest formula to calcul...

Mathematics, 27.07.2020 05:01, jordanjones022

PLEASE HELPPP
Instructions: Find the missing side. Round your answer to the

nearest tenth

English, 27.07.2020 05:01, MeowieMeowMeow6500

Is band a simple subject?...

Chemistry, 27.07.2020 05:01, caleb258

if your acetic acid buret was still wet inside with deionized water when you filled it with acetic acid?...

Biology, 27.07.2020 05:01, king3620

Which of the following statements is false Environmental sciences...

Mathematics, 27.07.2020 05:01, Mitchmorgan3816

Identify the values of the variables that complete the table to show the equivalent fractions, decimals, and
percents....

English, 27.07.2020 05:01, Dweath50

Shakespeare A Man and His Plays...

Geography, 27.07.2020 05:01, QUEEN2267

Exisem estados com duas ou mais naçoes que apresentam lingua e traços culturais distintos.E o caso do Canada como vivem dentro dessa culturas os canad...

English, 27.07.2020 05:01, amy290

Read the excerpt from "A Quilt of a Country." America is an improbable idea. A mongrel nation built
of ever-changing disparate parts, it is hel...

History, 27.07.2020 05:01, nsbegay2007

Sobre quien ejerce el poder de la Constitución...

Mathematics, 27.07.2020 05:01, edwardordonez66

Please answer this question now in two minutes

Mathematics, 27.07.2020 05:01, dummyboi57

Line L1 is horizontal and passes through (-5,8). Line L2 is vertical and passes through (4,-1). Find the point of intersection of L1 and L2...

World Languages, 27.07.2020 05:01, williamsa24mr238org

Choose the cases for the word(s) in all capitals. The ROADS also gave the ROMANS swift transportation for other purposes by which their lives were imp...

Mathematics, 27.07.2020 05:01, murphyscott794

Draw a diagram of this statement, Fifteen thousand dollars was raised by the booster club. This was two thirds of
the goal.
Use your diag...

History, 27.07.2020 05:01, mia7955

What should be done to repair damage done by hanford to northwest indian communities physical and spiritual lives?...

Mathematics, 27.07.2020 05:01, genyjoannerubiera

Can an absolute value function also be a polynomial function? Why or why not?...

Mathematics, 27.07.2020 05:01, knevis

HELP! Andrea has a $25 gift card
to a art store. She buys four canvases that are each the same price. If she now has $2.20 on her gift card, wh...

Вопросы и ответы категории > 2254