Before translation occurs, transcription must occur.
on occurs, transcription must occur. recall that transcription is
the formation of an mrna molecule from a dna template strand. de
from a dna template strand. determine the
sequence of nucleotide bases of the dna strand that the mrna molecule was
transcribed.

The Transcription mRNA

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

The translation product

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

Explanation:

Transcription is a process which transcripts the DNA to a molecule called mRNA or messenger RNA which contains code for the synthesis of amino acids.

The RNA nucleotide base pairs are added in the same way as in the DNA that is guanine will bind cytosine but adenine will bind uracil instead of thymine.

Since the start codon is AUG which codes for methionine and stop codons could be UAG, UAA or UGA which do not code for the amino acids during translation.

In the given question,  

Looking for the start codon which is AUG in the template strand is found and the transcript mRNA thus will be coded as

Template strand

3' AACTT- 5'

The Transcription mRNA

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

The translation product

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

The correct answer is: CGU.

Explanation:

Transcription is the process in which a specific DNA segment is taken and copied into RNA. This is highly important since proteins are made thanks to RNA and not DNA.

If an mRNA were to be transcripted using a segment of DNA containing CGT, it would form a GCA codon. The DNA strand serves as a model to synthesize the RNA strand, similar to how DNA replication happens, except RNA ends up having only one strand.

Since mRNA will have a GCA codon, the tRNA anticodon will be CGU (uracil replaces thymine).

GCA

Explanation:

Transcription is the process of copying the information in the DNA into an RNA molecule. It is the using of a DNA template to form a messenger RNA (mRNA).

Translation follows transcription, which is the process of using RNA as template to synthesize amino acids sequence (proteins). Translation occurs in the RIBOSOME, with the aid of the transfer RNA (tRNA). The tRNA helps read the mRNA codon with the anticodon that is complementary to the codon sequence.

Hence, if the mRNA codon has a CGT sequence, only a tRNA will ANTICODON sequence GCA, will be able to bind to it.

AUG GGU CGA UUU GCA GUA

Explanation:

MET GLY ARG PHE ALA VAL

5'UACGGGCCCACAGCAUCAACU3'

4. c. Deletion/ frameshift mutation

5. a. Tyr Tyr Asp Ser Gly

6. A frameshift occurred which altered the identity of the amino acids following the initiator 6. methionine, but not the length of protein Q.

Explanation:

4)

A single base pair at the first position of the Arg codon i.e. CGA has been deleted. Due to the deletion, the reading frame has shifted one nucleotide backwards, altering the amino acid sequence of the protein.

5)

The genomic DNA sequence is 5'-ATG ATA CTA AGG CCC-3'. Therefore, the complementary mRNA will be 5'-UAC UAU GAU UCC GGG-3'. According to the genetic code, this mRNA sequence encodes the following amino acid sequence: Tyr Tyr Asp Ser Gly

6)

The wild type DNA sequence is:

5'--3'

The mutant i.e. mRNA with the added G will be

5' -3'  

This is a single base pair insertion and frameshift mutation that shifts the reading frame one base pair forwards. The codon that was originally GAG coding for glutamic acid (Glu) gets converted to GGA that codes for glycine. Therefore, the amino acid sequence has been altered but the polypeptide chain will still have 13 amino acids.